What is a genealogist to do once he or she has traced her ancestors as far back as possible; that is, as far as the written records go? Let's talk genetics for a moment. As you may know, a person is made up of 23 pairs of chromosomes, or 46 total: half from mom, half from dad. Of these 23 pairs, a female would have a pair of XX chromosomes, which signifies the female gender. The male would have an XY pair, signifying the male gender. In males, unmatched X and Y chromosomes exchange DNA only at the ends of the two chromosomes (pseudoautosomal regions).
Chromosomes are composed of DNA, which itself is composed of 4 nucleotides: A (adenine), T (thymine), C (cytosine) and G (guanine). These letters, ATCG, are the ones we follow. Currently there are 2 genetic methods of finding out if you are related to someone who may be an ancestor, whether living or deceased.
The first method is "y polymorphism". In the Western culture, we have always traced our ancestors back in time by following the paternal line. In order to do this genetically, we must follow the y chromosome. Polymorphism is a term to show that mutations do occur in the Y chromosome, as can happen with other chromosomes. Note that the Y chromosome for the most part does not change (except for a small part of the pseudoautosomal regions). Different combinations of polymorphisms are known as haplotypes. Thus we are able to look at these changes and establish a genetic relationship between 2 living people (or 1 living, 1 deceased; or 2 deceased). This y polymorphism test is relatively new, and studies recording the frequency of different combinations of polymorphisms is even newer.
The second method is called mitochondrial DNA, or mtDNA analysis. This method involves the analysis of DNA found in the mitochondria, not the nuclear DNA of the nucleus of the body's cells (thus not the 23 pairs). You must note that in using this method, you are tracing ancestors through the maternal, not paternal, line. This is because mitochondrial DNA is passed from the mother to her children. Again, please understand that the molecular biology techniques used in mitochondrial DNA analysis should not be confused with DNA fingerprinting which is carried out on nuclear DNA.
In both methods you look for the most recent common ancestor (MRCA) of the 2 individuals. The assumption here is that the number of nucleotides (ATCG) differing in 2 individuals increases on average in relation to the temporal distance from their last common ancestor. In other words, the closer in time, the higher the number of matching nucleotides.
What does all of this mean? It means that as a genealogist, I have gone back in the records as far as I can for ancestors with my surname. I want science to take over now. It may be an expensive solution, but maybe in time that cost would decrease. I would like to be able to test genetically myself and LIVING members of other clans with the same or variant surname to see if we are related, and to find out how long ago our most recent common ancestor lived. Since I am tracing my paternal line, naturally I would use the y polymorphism method instead of the mtDNA method.
Let's take an example showing the 2 methods and how the results are totally different. Using the y polymorphism DNA method, genetic markers are used on my y chromosome and on the y chromosome of my presumed cousin with the same surname in Belgium. Buccal cells (cheek cells) can be used instead of blood samples. The results are compared and if the electrophoretic bandwidths are very similar, then each of us had a most recent common ancestor (MRCA) within so many years. I don't know how they would figure out how long ago this MRCA lived, let's call him Adam, but it is conceivable that a basic rate of y mutations might be applicable, at least for estimating purposes.
Now what if you had also done a mtDNA analysis?. You traced your mitochondrial DNA through your mother, her mother, her mother, etc., and maybe the Belgian cousin did the same through his maternal line. You compare the results to find the MRCA, or let's call her Eve. Can you compare results of the y polymorph test with any significance to the mtDNA test? Actually, no, because the women whom you have traced using the mtDNA analysis were not the ones married to the males you traced in the y polymorphism analysis.
Let's get back to the Y polymorphism method. There are 4 chromosome changes that do occur from generation to generation, and these are known as markers:
- indels: these are insertions or deletions of the DNA at particular locations on the chromosome. An example is the YAP (Y chromosome alu polymorphism).
- snips (SNP's): these are single nucleotide polymorphisms in which a particular nucleotide is changed (like A is changed to G). Since snips and indels (stable alus) are very rare, they also are known as unique event polymorphisms (UEPs).
- microsatellites: these are short sequences of nucleotides (generally 4 nucleotides: an example is GATA, where, for example, the nucleotide guanine is represented by "G") which are repeated over and over again a number of times in tandem; they are generally 2 to 5 nucleotides long. Changes sometimes do occur, however, and the number of repeats found at an allele may increase or decrease.
- minisatellites: these are longer sequences of nucleotides which are repeated over and over again a number of times in tandem. They are greater than 5 repeats long and more likely are 10 to 60 base pairs in length. The number of repeats often extends to several dozen. An example of a Y chromosome mini repeat is CACAATATACATGATGTATATTATA (Type 1). Changes sometimes do occur, however, and the number of repeats may increase or decrease.
Take this example given by Bradman, Neil and Mark Thomas, "Why Y? The Y Chromosome in the Study of Human Evolution, Migration and Prehistory", Science Spectra, No. 14, 1998:
Imagine that many years ago the Y chomosome of a particular man acquired the YAP insert; we call him YAP+. That man had one or more sons, sons who carried the YAP+ insert on their Y chromosomes. In turn, at least one of the man's sons (a grandson of the original YAP+) had one or more of his own sons ... and so the process continued with the number of male offspring increasing until there were many men who had Y chromosomes with YAP+. Imagine further that in one such descendant, an A at one particular place on the Y chromosome was exchanged for a G and that the man in whom this took place also gave rise to an unbroken line of male descendants. There were now individuals in the population with the haplotype YAP+A and others with YAP+G, as well as those without the YAP insert whom we might designate as YAP-A. One of the Y chromosome microsatellites (DYS19) is found in various lengths (alleles) called 11, 12, 13, 14, etc. Thus, the haplotype of a man descended from the individual in whom A was mis-copied to G (who was, in turn, a descendant of the man in whom the YAP+ was inserted), and who has a DYS19 polymorphism of length 14, is described as YAP+ sY81 (G) DYS19(14). Haplotypes can be used to construct trees describing the evolutionary history of the Y chromosome; in such evolutionary trees, UEPs provide the trunk and branches, and microsatellites the twigs.
ليست هناك تعليقات:
إرسال تعليق